[SOLVED] RNA to Protein simulation program's TypeErorr?

Issue

Here’s what I’m doing:


def dna_complement(dna):
  coup = ""
  for letter in dna:
    if letter == "C":
      coup += "G"
    if letter == "G":
      coup += "C"
    if letter == "A":
      coup += "T"
    if letter == "T":
      coup += "A"
  return coup
  

def convert_to_rna(dna):
  coup2 = ""
  for letter in dna:
    if letter == "C":
      coup2 += "G"
    if letter == "G":
      coup2 += "C"
    if letter == "A":
      coup2 += "U"
    if letter == "T":
      coup2 += "A"
  return coup2

def translate(rna):
  amino_acid = ""
  for len in rna:
    if range(0, len(rna), 3) == "UUU" :
      amino_acid = CODON_TABLE.get("UUU")
    if range(0, len(rna), 3) == "UUC" :
      amino_acid = CODON_TABLE.get("UUC")
    if range(0, len(rna), 3) == "UUA" :
      amino_acid = CODON_TABLE.get("UUA")
  


CODON_TABLE = {'UUU':'Phe','UUC':'Phe','UUA':'Leu','UUG':'Leu','CUU':'Leu','CUC':'Leu','CUA':'Leu','CUG':'Leu','AUU':'Ile','AUC':'Ile','AUA':'Ile','AUG':'Met','GUU':'Val','GUC':'Val','GUA':'Val','GUG':'Val','UCU':'Ser','UCC':'Ser','UCA':'Ser','UCG':'Ser','CCU':'Pro','CCC':'Pro','CCA':'Pro','CCG':'Pro','ACU':'Thr','ACC':'Thr','ACA':'Thr','ACG':'Thr','GCU':'Ala','GCC':'Ala','GCA':'Ala','GCG':'Ala','UAU':'Tyr','UAC':'Tyr','UAA':'STOP','UAG':'STOP','CAU':'His','CAC':'His','CAA':'Gln','CAG':'Gln','AAU':'Asn','AAC':'Asn','AAA':'Lys','AAG':'Lys','GAU':'Asp','GAC':'Asp','GAA':'Glu','GAG':'Glu','UGU':'Cys','UGC':'Cys','UGA':'STOP','UGG':'Trp','CGU':'Arg','CGC':'Arg','CGA':'Arg','CGG':'Arg','AGU':'Ser','AGC':'Ser','AGA':'Arg','AGG':'Arg','GGU':'Gly','GGC':'Gly','GGA':'Gly','GGG':'Gly'}

""" the rna is "UUCUCUACGGUAACAGGGGGCCGGAGGACGACGACGAGAAUCGCCCCGGUGUAGCCGGUGGCGACGGGACGGGGACCUCCCACCGGGGUGGCCGGCAAUGUCGCUCGUAUG" # This is already converted from DNA to RNA so there's no worry about the original RNA
"""

dna="AAGAGATGCCATTGTCCCCCGGCCTCCTGCTGCTGCTCTTAGCGGGGCCACATCGGCCACCGCTGCCCTGCCCCTGGAGGGTGGCCCCACCGGCCGTTACAGCGAGCATAC" 

def main():
  print("\nWelcome to the DNA program: The Code of Life.")
  print("\nSample DNA strand:\n")
  print("Regular DNA:")
  print_bases(dna)
  print("DNA after complement: ")
  dna2 = dna_complement(dna)
  print_bases(dna2)
  print("DNA after RNA convertion: ")
  rna = convert_to_rna(dna)
  print_bases(rna)
  print("The result of translation: ")
  amino_acid = translate(rna)
  print(amino_acid)

As in the image above. (Thanks to a user called Random Davis telling me to correct my mistake on the description, now I have everything I’m having right now in display which might be a little better)

When I tried to run this the Type Error telling me that str object is not callable, can someone help me with this?

More information: Sorry for not saying this earlier, I was trying to get the conversion like UUU <-> Phe, UUA <-> Leu, and AUU <-> Ile. And stop the protein from generating once it detected UAA, UAG, UGA.

Solution

So if you turn the whole RNA string into a codon string:

CODON_TABLE = {'UUU':'Phe','UUC':'Phe','UUA':'Leu','UUG':'Leu','CUU':'Leu','CUC':'Leu'} # etc

def translate(rna):
    amino_acid = ""
    for i in range(len(rna)-2):
        three_letter = rna[i:i+3]
        if three_letter in CODON_TABLE:
            amino_acid += CODON_TABLE[three_letter]
            # if a match is found, don't look for a new codon starting with
            # the second or third letter of this codon
            i += 2 
        return amino_acid

Explanation:
for i in range(len(rna)-2): will give us an index number to the parts of the RNA string we want to read:

UUCUCUAC   len = 8
012345      i = 0-5 = range(6)

rna[i:i+3] gives us the three letters starting from the ith one

UUCUCUAC  = rna
UUC       i = 0, three_letter = rna[0:3]
 UCU      i = 1, tl = rna[1:4]
  CUC     i = 2, tl = rna[2:5]
   UCU    i = 3, tl = rna[3:6]
    CUA   i = 4, tl = rna[4:7]
     UAC  i = 5, tl = rna[5:8]

For each three-letter sequence, if it’s a codon, it adds the name of the codon to the amino acid

amino_acid += CODON_TABLE[three_letter]

Then it skips i forward by 2 to avoid looking for another codon starting with letters we’ve already used:

UUCUCUAC
UUC       Phe
 UCU      (skip)
  CUC     (skip)
   UCU    Ser
    CUA   (skip)
     UAC  (skip)

If it finds something that’s not a codon, it ignores it and moves onto the next three letters. (I’m not a biologist, I don’t know if every three-letter sequence is a codon?)

UUCZUCUAC
UUC        Phe
 UCU       (skip)
  CUC      (skip)
   ZUC     (not found)
    UCU    Sre

Answered By – Jack Deeth

Answer Checked By – Candace Johnson (BugsFixing Volunteer)

Leave a Reply

Your email address will not be published.